
Top : Science : Biology : Bioinformatics :
Software
Categories
| Online Services @ Software for Evolutionary Biology @ Software for General Biology @ Software for Genetics @ Software for Taxonomy @ |
Websites
A visualization software system for evaluation of hybridisation experiments.
site exerpt
Welcome to the Xdigitise Home Page Xdigitise is a visualization software system for evaluation of hybridisation experiments. Current release is Xdigitise V3.5 (tested on Digital UNIX/OSF/TRU64 UNIX and Linux for more information click on the features link below: Xdigitise V3.5 Features Xdigitise V3.5 Usermanual (in HTML...Developers of software for real time PCR primer design, TaqMan, molecular beacons, SYBR green, FRET, DNA microarray analysis, restriction cloning, plasmid maps, gateway cloning, protein interaction network and functional genomics.
site exerpt
PREMIER Biosoft International Pacific more testimonials Citations Prestigious Clients Software to Accelerate Research in Molecular Biology AlleleID (for Pathogen Detection using qPCR assays) A comprehensive desktop tool designed to address the challenges of pathogen detection, bacterial identification, species identification and taxa discrimination using...Links to Bioinformatics software for Linux. From the Linux Software Encyclopedia.
site exerpt
Ba-Bm A program designed to interconvert many file formats used in molecular modeling. BABEL is capable of assigning hybridization, bond order, and connectivity when these elements are not present in the input file. The formats that BABEL can read are: Alchemy,...Provides free downloadable MEGA2 software for use in comparative sequence analysis of genetic data. Program for Win32 platforms.
site exerpt
MEGA Molecular Evolutionary Genetics Analysis A is an integrated tool for automatic and manual sequence alignment, inferring phylogenetic trees, mining web-based databases, estimating rates of molecular evolution, and testing evolutionary hypotheses. Authors: Sudhir Kumar Director of the Center for Evolutionary Functional Genomics Biodesign Institute Arizona...The proBiosys suite of programs compares phenetic, chemotaxonomic and nucleic acid sequence data. Algorithms for polyphasic taxonomy are available to construct Dendrograms, the suite is simple to use.
http://www.proBiosys.com
Production software used at the Sanger Centre, physical mapping software, informatics and analysis software, and data formats
site exerpt
The Sanger Institute: Software Production sequencing software is used throughout the sequencing procedure from preparation of DNA through to finishing of clones Production Sequencing Software BLAST Blixem Crossmatch Dotter Gap4 Phrap Phred Staden Package Physical mapping software comprises various packages which order clones and...Software and an online service for periodically performing predefined searches at NCBI, reporting new results by email or on the web.
site exerpt
PubCrawler Home Page You will be forwarded to PubCrawler's Home Page immediately. Alternatively, simply follow this link: http pubcrawler.gen.tcd.ie....basecaller / assembler / sequencer finisher and related tools from the UW Genome Center.
site exerpt
Green Group Laboratory of PHIL GREEN CCAGTAATGCACGAGACACAAA +C A++GCACG CA YCMRYAWKGCACGWSRCASWMR...WU-BLAST: The Washington University BLAST. "...faster at any sensitivity, more sensitive at any speed, the first BLAST with gapped alignments and statistics."
site exerpt
WU-BLAST Serving the world community since 1995 Faster at any sensitivity, more sensitive at any speed, the original gapped BLAST with statistics, providing the performance, features and reliability demanded by technical professionals: WU BLAST 2.0 setting a higher standard For licensed...William Pearson's package for fast sequence comparison
ftp://ftp.virginia.edu/pub/fasta
A fairly old sequence analysis tool for everyday lab use. Formerly a commercial product - now "abandonware."
site exerpt
Download Gene Runner for Windows Download Motif Runner for Windows...Commercial sequence analysis and manipulation suite for Windows and Macintosh.
http://www.dnastar.com/
An interactive tool for peptide and nucleotide sequence analysis
http://cbrg.inf.ethz.ch/Darwin/index.html
A widely-used program for calling DNA sequence bases from sequencer trace files.
site exerpt
PHRED Base-Calling Software with Quality Information Phred can read trace data from SCF files and ABI model 373 and 377 DNA sequencer chromat files, automatically detecting the file format. After calling bases, phred writes the sequences to files in either FASTA format, the format suitable for...An integrated linux environment for bioinformatics and evolutionary analysis based on the Genetic Data Environment (GDE). Contains binaries for Linux and Mac OS X, documentation, screenshots, references, and organism specific interfaces.
site exerpt
BioAfrica genetic data environment (GDE) for Linux download An integrated linux environment for bioinformatics and evolutionary analysis based on the Genetic Data Environment (GDE Supported by The Welcome Trust U.K grant 061238 Bioinformatics Unit at Africa Centre, Nelson R Mandela School of Medicine, University of Natal, South Africa....Software for life science discovery; enterprise-level data integration and desktop biologists.
site exerpt
geneticXchange Life. Science. Discovery. Hub is the fastest and most comprehensive discovery middleware platform on the market today. DiscoveryHub solves the life science data explosion by providing a robust management platform for complete data integration and access. please wait, while the page loads If...Freeware DNA cloning, analysis and visualization software.
site exerpt
pDRAW32 freeware DNA cloning, sequence analysis and plasmid/DNA plotting software This scientific software will also assist you in restriction enzyme analysis and mapping, homing enzymes mapping, finding dam and dcm methylation sites, finding and calculating Tm for oligonucleotide primer sites, finding open reading frames (ORF) and perform protein translation using...Makes available various bioinformatics algorithms, which perform all essential tasks in sequence analysis and sequence-based predictions.
site exerpt
metalife with the knowledgebase developed by metalife and the corresponding bioinformatics-software tools, new standart for the future of intelligentbioinformatics are set. Search: Lycos Tripod Gear Factor Share This Page Report Abuse Edit your Site Browse Sites 171; Previous Top 100 Next 187; there is no doubt that in this millennium biotechnology is turning out to be one of the most important...A freeware Mac OS X application written in Java that does many standard types of DNA and protein sequence analysis tasks.
site exerpt
Sequence Analysis for Mac OS X I have written over the past several years for various clients in my work as a bioinformatics consultant. These clients have graciously allowed me to release these works into the public domain as freeware for Macintosh OS X in order...A free sequence database application for Unix. It includes a sequence editor, several sequence aligners, phylogeny reconstruction tools, probe/primer search and generation, genome annotation and visualization. In addition to the integrated user-interface the ARB database can be accessed using Perl or C.
site exerpt
The ARB project Klicken sie hier um zu der Seite die sie angesteuert haben zu gelangen...Search for Tandem Repeats IN Genomes -- Includes C source code and examples.
site exerpt
Index of castri/STRING Index of castri/STRING Name Last modified Size Description Parent Directory Huntington.out 27-Feb-2003 14:37 217 Huntington.ris 27-Feb-2003 14:37 1.5K Huntington.seq 27-Feb-2003 14:37 13K Huntington.tab 27-Feb-2003 14:37 178 Stucco.jpg 27-Feb-2003 14:37 7.0K bich10.gif 27-Feb-2003 14:37 7.4K const2.gif 27-Feb-2003 14:37 1.7K email106.gif 27-Feb-2003...Sfold predicts probable RNA secondary structures, assesses target accessibility, and provides tools for the rational design of RNA-targeting nucleic acids. The web server version is free for academic use.
site exerpt
Sfold Software for Statistical Folding and Rational Design of Nucleic Acids Target accessibility prediction and RNA duplex thermodynamics for rational siRNA design Target accessibility prediction and rational design of antisense oligonucleotides and nucleic acid probes Target accessibility prediction and rational design of trans-cleaving ribozymes General features and output for statistical RNA...Object-oriented regulation network simulator written in Java. Includes downloadable software and documentation. The site is in French and English.
site exerpt
Gints English Franais...Free software for working with and managing nucleotide sequences in multiple formats. Many features including sequence annotation, restriction analysis, pattern searching, retrieval from servers. Released under GNU Public Licence.
site exerpt
AnnHyb Hyb is a tool for working with and managing nucleotide sequences in multiple formats. The features include format conversion, sequence viewer, sequence editor, oligonucleotides alignment, restriction analysis, pattern searching, retrieval from servers, multi-alignment viewer, consensus determination AnnHyb is free software,...Extendable parallel system for automatic genome analysis. Software for analysing all potential genes in a defined genome region. Given two marker names, can output reports of genomic features between them. Features for converting between naming systems, sequence retrieval, E-PCR, gene prediction, similarity search, protein pattern search, and report formatting. Written in Java.
site exerpt
Sight, web agent generator Automatic running of bioinformatical tools on remote servers Audrius Meskauskas, Frank Lehmann-Horn, Karin Jurkat Rott Download Cross platform installer Application examples Workflow concept overview Using Sight agents in user java applications Motivation: Bioinformatical tools on remote servers can be used...The European Molecular Biology Open Software Suite. An open source project started by the EMBnet community in order to replace proprieatry systems like GCG.
http://www.rfcgr.mrc.ac.uk/Software/EMBOSS/
Bibliographic site for management and alignment of bacteria and fungi sequences.
http://pbil.univ-lyon1.fr/bibi/query.php
AbOrygen develops the next generation of bioinformatics software with powerful new features that simplify and improve the research work of life scientists worldwide.
site exerpt
AbOrygen Intuitive bioinformatics Experience the most innovative and intuitive molecular biology software designed to simplify and improve the research work of life scientists worldwide. Breakthrough features in biOpen include dynamic and seamless integration of sequence analysis tools, unique and powerful display capabilities, and...NSF supported project to make old computers accessible to new software in bioinformatics. Provides transitional and supplemental support, especially in structual biology, for software packages on various platforms.
site exerpt
ARCiB Accessible Retired Computers in Biology Work sponsored in part by the National Science Foundation under AwardsDBI-0315281 and DBI-0203064 Any opinions, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science...A graphical user interface for linear modelling of cDNA and oligonucleotide microarray data to identify differentially expressed genes.
site exerpt
limmaGUI Unless you are using the windows installation wizard, you should install the other required R packages before installing limmaGUI. The other R packages required are listed at the bottom of this webpage. 1.1 Download limmaGUI as an R package The...Normalization tests for differentially expressed genes, clustering, bootstrapping, leave-one-out validation, cross-fold validation, and links to external genomic databases.
site exerpt
caGEDA: A web application for the integrated analysis of global gene expression patterns in cancer A web application for the integrated analysis of global gene expression patterns in cancer A paper describing caGEDA has been published. Click here to download PDF A paper describing the PPST and ABA tests has been published. Click here for...Accelerated sequence analysis tools for HMMsearch and Smith-Waterman.
site exerpt
Logical Depth Depth software accelerates searches by an order of magnitude on standard hardware. Our profile Hidden Markov Model and Smith-Waterman sequence analysis software delivers the best price/performance on Pentium 3, Pentium 4, Opteron, or Athlon64 processors. LDhmmer LDhmmer consists of LDhmmsearch..."Protocols for Manipulating Biological Data": a set of tools that filter, format, and merge data in tabular or common biological formats; organized as a classified collection of Perl one-liners.
http://cgr.harvard.edu/cbg/scriptome/
Java program to display a DNA sequence, annotated with features, ORFs. Reads many input formats.
site exerpt
The Sanger Institute: Informatics Software: Artemis A sequence viewer and annotation tool Introduction Artemis is a free genome viewer and annotation tool that allows visualization of sequence features and the results of analyses within the context of the sequence, and its six-frame translation. Artemis is written...